Skip to main content

Advertisement

Table 1 Primers used for Semi quantitative-PCR analysis

From: Cardiac hypertrophy is stimulated by altered training intensity and correlates with autophagy modulation in male Wistar rats

Gene Symbol Primer Sequence (5′ to 3′) Upper strand: sense Lower strand: antisense Product Size (bp) Annealing (°C) Cycle References
αMHC GAGCAGGAGCTGATCGAGAC 151 60 35 [26]
CCTCTGCGTTCCTACACTCC
PIK3CA ACCTCAGGCTTGAAGAGTGTCG 137 59 35 [27]
CCGTAAGTCGTCGCCATTTTTA
mTOR CTGATGTCATTTATTGGCACAAA 170 57 35 [28]
CAGGGACTCAGAACACAAATGC
LC3 GGTCCAGTTGTGCCTTTATTGA 153 59,5 35 [28]
GTGTGTGGGTTGTGTACGTCG
p62 CTAGGCATCGAGGTTGACATT 116 56 35 [29]
CTTGGCTGAGTACCACTCTTATC
GAPDH GTTACCAGGGCTGCCTTCTC 177 61 35 [30]
GATGGTGATGGGTTTCCCGT