Skip to main content

Table 1 Specific primers used for the determination of different microorganisms

From: No effects of a 4-week post-exercise sauna bathing on targeted gut microbiota and intestinal barrier function, and hsCRP in healthy men: a pilot randomized controlled trial

Name Product description Sequence
Praus-F480 Faecalibacterium prausnitzii forward starter CAGCAGCCGCGGTAAA
Praus-R631 Faecalibacterium prausnitzii reverse starter CTACCTCTGCACTACTCAAGAAA
Akk.muc-F Akkermansia muciniphila starter forward CAGCACGTGAAGGTGGGGAC
Akk.muc-R Akkermansia muciniphila starter reverse CCTTGCGGTTGGCTTCAGAT
F-Bifid09c Bifidobacterium spp. forward starter CGGGTGAGTAATGCGTGACC
R-Bifid06 Bifidobacterium spp. reverse starter TGATAGGACGCGACCCCA
Bacter11 Bacteroides spp. forward starter CCTWCGATGGATAGGGGTT
Bacter08 Bacteroides spp. starter reverse CACGCTACTTGGCTGGTTCAG
Uni-F340 Starter universal forward ACTCCTACGGGAGGCAGCAGT
Uni-R514 Starter universal revers ATTACCGCGGCTGCTGGC