Skip to main content

Table 1 The sequences of PPARγ, UCP2, and GAPDH primers for polymerase chain reaction

From: The effect of omega3 fatty acid supplementation on PPARγ and UCP2 expressions, resting energy expenditure, and appetite in athletes

Name Base pair Sequences (5′ 3′)
UCP2 (Forward) 18 GGCTGGAGGTGGTCGGAG
UCP2 (Reverse) 22 CAGAAGTGAAGTGGCAAGGGAG
PPARγ (Forward) 20 CTTCCATTACGGAGAGATCC
PPARγ (Reverse) 19 AAAGAAGCCAACACTAAAC
GAPDH (Forward) 20 CTGACTTCAACAGCGACACC
GAPDH (Reverse) 23 CGTTGTCATACCAGGAAATGAGC
  1. PPARY Peroxisome proliferator-activated receptor-gamma, UCP2 Mitochondrial uncoupling protein 2, GAPDH glyceraldehyde 3 phosphate dehydrogenase