Skip to main content
Download PDF

Association between ACTN3 (R577X), ACE (I/D), BDKRB2 (-9/+9), and AGT (M268T) polymorphisms and performance phenotypes in Brazilian swimmers

BMC Sports Science, Medicine and Rehabilitation volume 16, Article number: 50 (2024) Cite this article

Abstract

Background

The influence of genetic polymorphisms on athletic performance has been widely explored. This study investigated the interactions between the polymorphisms ACTN3 (R577X), ACE (I/D), BDKRB2 (-9/+9), and AGT (M/T) and their association with endurance and strength phenotypes in Brazilian swimmers.

Methods

123 athletes (aged 20–30 years) and 718 controls participated in the study. The athletes were divided into elite and sub-elite (N = 19 and 104, respectively) and strength and endurance experts (N = 98 and 25, respectively). Hardy-Weinberg equilibrium was observed in all groups.

Results

Considering the ACE polymorphism, it was observed a higher frequency of the DD genotype than expected in the strength experts of the elite group, whereas the strength experts sub-elite athletes had a higher frequency of the ID genotype (χ2 = 8.17; p = 0.01). Subjects with XX genotypes of ACTN3 are more likely to belong to the athlete group when compared to the control group (OR = 1.79, p = 0.04). The DD homozygotes of the ACE are more likely to belong to the elite group with strength phenotypes than the group of sub-elite (OR = 7.96, p = 0.01) and elite strength experts compared to elite endurance (OR = 18.0, p = 0.03). However, no significant differences were observed in the allelic distribution of the polymorphisms evaluated when comparing Elite, sub-elite athletes and controls.

Conclusion

ACE and ACTN3 allele frequencies should be considered with regard to performance influencing factors in Brazilian swimmers.

Peer Review reports

Background

Sports performance is influenced by several factors, including interactions between genetic and environmental aspects that affect the variation and modulation of phenotypic characteristics [1]. Genotypic characteristics distinct elite athletes from non-athletes and even sub-elite athletes [2]. In the field of genetics applied to elite swimming, studies point out interactions between genotypic profiles of some candidate polymorphisms and strength/power phenotypes, associated with short-distance events (≤ 200 m) performed in Olympic-size swimming pools [3]. Likewise, genotypic profiles associated with resistance phenotypes are observed, commonly related to long events (≥ 400 m) performed in official pools or in open water [3, 4].

In the field of genetics applied to elite swimming, studies point out interactions between genotypic profiles of some candidate polymorphisms and strength/power phenotypes, associated with short-distance events (≤ 200 m) performed in Olympic-size swimming pools [3]. In short-distance swimming events, the alpha-actinin-3 (ACTN3) polymorphism is associated with power/strength phenotypes, with emphasis on the higher frequency of the R allele and the RR and RX genotypes [5]. The angiotensin-converting enzyme (ACE) I allele and II + ID genotypes are commonly associated with endurance phenotypes, especially among top-elite long-distance specialist athletes [3]. Regarding the bradykinin B2 receptor polymorphism (BDKRB2), -9 allele has been associated with endurance phenotypes [6], whereas + 9 was observed to be over-represented in short-distance in elite swimmers [7]. Similarly, it has been demonstrated a positive correlation between the angiotensinogen (AGT) M allele and the MT + MM genotypes and the resistance phenotypes, whereas the T allele has been associated with power/strength phenotypes [4].

To the best of our knowledge, there are no studies simultaneously investigating the association of ACTN3 (R577X), ACE (I/D), BDKRB2 (-9/+9), and AGT (M/T) polymorphisms with strength/power and endurance performance phenotypes in high-level Brazilian swimmers. Investigating the effect of the interaction between candidate polymorphisms and athletic performance in Brazilian swimmers can provide valuable insights into the genetic factors that may influence their abilities. Therefore, the main objective of the study was to identify and characterize the allelic and genotypic distribution of the aforementioned polymorphisms and their possible associations with Brazilian swimming athletes specialized in short (≤ 200 m) or in long events (≥ 400 m). It was hypothesized that the ACTN3 (R577X), ACE (I/D), BDKRB2 (-9/+9), and AGT (M/T) polymorphisms could influence the performance of swimming athletes.

Methods

Participants

A convenience sample was formed with 123 high-level Brazilian swimmers (76 men and 47 women aged between 20 and 30 years). They were initially divided by technical level and sporting experience (national and international) into an elite group (n = 19) and a sub-elite group (n = 104). The elite group was formed by athletes who represented the national team in international competitions, world championships and the Olympic Games, whereas the sub-elite group was formed by athletes who participated only in national-level championships. Later, the participants were also divided according to the swimming events at which they were expert. Short distance swimmers (≤ 200 m) were assigned to the power-strength phenotype (n = 98) and long-distance swimmers (≥ 400 m) were assigned to the endurance phenotype (n = 25). Only athletes between 18 and 40 years old affiliated with the Brazilian Confederation of Water Sports (BCWS) who signed the informed consent form were eligible for inclusion. Exclusion criteria were to be suffering from any chronic pathology or an injury in the month prior to the investigation, not to be affiliated with the BCWS during the study or not to give their informed written consent to participate. Finally, an age-matched control group (n = 718) composed of healthy non-athletes from Southwest and Central-west regions of Brazil representing the general population was formed.

Information regarding the main events attended by each athlete, as well as their technical index and experience (national and international), were verified on the BCWS official website (https://cbda.org.br/cbda/natacao/atletas). This study was carried out in accordance with the principles of the Declaration of Helsink and was approved in 2015 by the Research Ethics Committee of the Brasilia Catholic University, Brazil, under protocol 1.319.640. All subjects signed the informed consent form according to resolution 466/12 of the National Health Council.

Genotyping

The genomic deoxyribonucleic acid (DNA) of the buccal mucosa cells were collected by scraping with a specific swab and the extraction was performed following the Chelex Resin protocol (BioRad Laboratories, Hercules, CA). DNA quantification and evaluation was performed in a NanoDrop® ND1000 spectrophotometer. The DNA used in the standard amplification reactions was diluted in autoclaved ultra-pure water.

The ACTN3 (rs1815739) was genotyped by the allelic discrimination method in quantitative Polymerase Chain Reaction (qPCR) using TaqMan Assays by the high-performance QuantStudio™ 6 Flex Real-Time PCR System (Foster City, CA, USA). ACE polymorphism genotyping was performed as previously [8]. The BDKRB2 genotype analysis was performed using 2 specific primers (forward 5’-TCCAGCTCTGGCTTCTGG − 3’ and reverse 5’- AGTCGCTCCCTGGTACTGC- 3’), in order to amplify and classify individuals as homozygotes (+ 9/+9 or -9/-9) or heterozygotes (+ 9/-9). AGT gene was examined using a polymerase chain reaction and the primer pairs used for its amplification were forward 5′CAGGGTGCTGTCCACACTGGACCCC′3′ and reverse 5′CCGTTTGTGCAGGGCCTGGCTCTCT′3.

After the genotype analysis step, total volume was loaded on a 2% agarose gel for the ACE, 3% for the AGT, and 4% for BDKRB2. Afterwards, the volume was subjected to electrophoresis for 30–35 min according to the expected amplicon patterns. The genotypes’ results were analyzed and interpreted using the iBright™ FL1500 Imaging System transilluminator (Thermo Fisher Scientific, USA). The visualization of the gene fragments after allelic discrimination and agarose gel electrophoresis can be seen in Supplementary File S1.

Statistical analysis

The genotypic frequencies were initially compared among the athletes divided by sex through the Chi-square (χ 2) test. Since there was no difference between sex allowed all volunteers to be analyzed together. Subsequently, Hardy-Weinberg equilibrium was verified between athletes in each of the four polymorphisms [9]. The genotypic frequencies of the athletes and controls were compared via the Chi-square test. 2 × 2 tables were used to compare the allelic frequency between groups for each polymorphism. In all comparisons, opposing phenotypic groups (power/strength vs. endurance) and sport status (elite vs. sub-elite) were considered. For all chi-square analyses, effect sizes were measured with the Cramer’s V statistic [10]. The Chi-square test was conditioned to the interpretation of the residue (R = observed value minus the expected value) and the adjusted residuals. The residual analysis allows pointing out which category of the group presents a significant value (positive value) and to determine the level of significance for the excess of occurrences through the adjusted residual. Thus, an adjusted residual greater than 1.96 indicated that the value was significantly larger than would be expected if the null hypothesis were true, with a significance level of 0.05. Additionally, the correspondence analysis test was performed to analyze the relationship between the categorical variables. Binary logistic regression was used to assess the odds ratio (OR) of the athletes with a certain genotypic characteristic belonging to the elite or sub-elite group considering codominant (1/1 vs. 1/2 and 1/1 vs. 2/2), dominant (1/1 vs. 1/2 + 2/2) and recessive (1/1 + 1/2 vs. 2/2) models. The significance level adopted for the statistical procedures was p ≤ 0.05. The statistical analysis was performed using the SPSS 22.0 software for Windows (IBM, USA).

Results

The genotypic distribution and allelic frequency for the ACTN3 (R577X), ACE (I/D), BDKRB2 (-9/+9) and AGT (M268T) polymorphisms are presented in Table 1. All genotypes were in Hardy-Weinberg equilibrium (p > 0.05).

Table 1 Genotypic and allelic frequencies of all the groups evaluated
Full size table

The genotypic distribution of swimmers for the polymorphisms analyzed was not significantly different between the elite, sub-elite, and control groups (Table 2). However, when comparing sub-elite and elite athletes with power/strength phenotypes, we found a statistically significant difference for ACE polymorphism (p = 0.017).

Table 2 Comparisons between the genotype frequencies of the studied groups via 2 × 2 Chi-square test
Full size table

The adjusted residue analysis verified that the observed frequency of the DD genotype was higher than expected in the power/strength elite group. In contrast, the sub-elite athletes with power/strength phenotypes presented a higher frequency of the ID genotype than expected (χ2 = 8.168; p = 0.013) (Table 3).

Table 3 Analysis of ACE polymorphism in the Elite power/strength vs. Sub-elite power/strength comparison
Full size table

Figure 1 presents the correspondence analysis between the ACE genotypes in relation to the elite power/strength athletes vs. sub-elite power/strength athletes. This figure was generated from the adjusted residual data presented in Table 3, which shows a greater association between the DD genotype and the elite power/strength group and the ID genotype with the sub-elite power/strength group.

Fig. 1
figure 1

Correspondence analysis of the ACE genotypes in relation to the elite power/strength and sub-elite power/strength athletes

Full size image

Figure 1. Correspondence analysis of the ACE genotypes in relation to the elite power/strength and sub-elite power/strength athletes.

The allelic frequencies and possible comparisons between groups are shown in Table 4. No significant differences were observed in the allelic distribution of the studied polymorphisms when comparing elite athletes, sub-elite athletes, and controls. Finally, Table 5 shows the comparisons with Odds Ratio between groups regarding genotypic distribution via codominant, dominant, and recessive models.

Table 4 Comparisons between the allelic frequencies of the studied groups
Full size table
Table 5 Comparisons via binary logistic regression with Odds Ratio between groups regarding genotypic distribution through codominant (1/1 vs. 1/2 and 1/1 vs. 2/2), dominant (1/1 vs. 1/2 + 2/2) and recessive (1/1 + 1/2 vs. 2/2) models
Full size table

Discussion

Competitive performance of swimmers is the result of the complex interaction between environmental, nutritional, physical, physiological, biomechanical, sociocultural and genetic factors [11, 12]. Regarding the genetic components, it is a challenging task to recognize specific markers that affect physical performance in elite sport [13]. In swimming, endurance and power/strength phenotypes are essential for athletes to stand out at an excellency level [3, 14].

The majority of studies involving candidate polymorphisms related to swimming performance have given more attention to either ACTN3 or ACE polymorphisms [3, 5, 14,15,16,17,18,19]. In addition, other polymorphisms have also been investigated, such as the NOS3 genes (G894T and − 786T/C) [20], insulin-like growth factor (IGF) [21], myostatin (MSTN) [22], as well as interleukin-6 (IL6), MCT1, peroxisome proliferator-activated receptor alpha (PPARA), PPARG coactivator 1 alpha (PPARGC1A) and vascular endothelial growth factor receptor 2 (VEGFR2) [23, 24].

This study raised the hypothesis that the ACTN3 (R577X), ACE (I/D), BDKRB2 (-9/+9), and AGT (M/T) polymorphisms could influence the physical performance of Brazilian swimmers. Previous investigations demonstrated that the ACE (I/D) polymorphisms may be associated with both sprint/power and endurance performances [25]. Our study observed an association between the ACE gene polymorphism and the performance of swimmers when comparing elite and sub-elite Brazilian swimmers with power/strength phenotypes, experts in short distance events (≤ 200 m). Furthermore, in the elite power/strength group, the frequency of the DD genotype was greater than expected. In contrast, the frequency of the ID genotype observed was higher than expected in the sub-elite power/strength group.

The results obtained in the present study are in line with the findings by Costa et al. [26], who found a higher frequency of the DD genotype in elite short-distance swimmers when compared to the control group and endurance swimmers (≥ 400 m). In fact, it has been suggested that the DD genotype can provide possible advantages in athletic performance when analyzing athletes from various sports at national and/or international levels, including swimming [27]. Furthermore, the ACE DD genotype has been demonstrated to be beneficial in short duration aerobic exercises (2–8 min) when associated with training [28]. Likewise, the presence of DD homozygotes is suggested to be advantageous for power/strength performance in sprinters and jumpers compared to endurance athletes [29].

Several studies support the association between ACE and sports performance [30, 31]. In our results, it was verified that athletes of the power/strength group with the ACE DD genotype are 7.96 times more likely to belong to the groups of elite athletes when compared to sub-elite athletes. However, the odds increase 18 times among elite swimmers with DD genotype of the power/strength group when compared to elite swimmers with endurance phenotypes. We also observed that ACE DD homozygotes are 5.1 times more likely to belong to the elite athletes of the power/strength group than the ID + II genotypes compared to sub-elite athletes with the same phenotypic characteristic.

Previous studies suggest that individuals with a higher frequency of the ACE DD genotype have greater strength/power than those with genotype II and ID overexpression [32]. A recent meta-analysis study found that the predominance of ACE genotype II is indicated as advantageous for the performance of individuals aiming for endurance performance [33]. In contrast, ID genotype is more frequently expressed among athletes who practice sports that require high aerobic activity [34].

The ACTN3 polymorphism has been extensively studied and associated with elite athletic performance [35, 36], including among swimming athletes [3, 5, 16, 18, 37]. The results of the present study showed that, regarding the ACTN3 gene, individuals with the XX genotype are 1.79 times more likely to belong to the athlete group when compared to the control group. According to Ahmetov et al. [38], the homozygous XX genotype of ACTN3 were significantly over-represented among endurance runners when compared to the control group, suggesting the need for both power and speed components for success in various endurance-oriented sporting events. Other studies have also shown that the XX genotype of ACTN3 has been associated with athlete status, especially in sports with endurance nature [18].

Although the different genotypes of ACE and ACTN3 polymorphisms influence the performance of athletes from different sport disciplines, these associations are not strong enough to predict the phenotypic characteristics of elite swimming athletes. Furthermore, the results of this study need to be interpreted considering the context of ethnic differences [39]. This study is limited by the small number of polymorphisms within a small and admixtured cohort. The data regarding individual genes lack a comprehensive analysis, and our study does not explore the more in-depth insights that could be obtained by considering haplotypes of several genes [40]. Therefore, further studies with different populations and a greater sample size would be suggested, since, to the best of our knowledge, this is the first study to verify the allele and genotypic frequency of the polymorphisms ACTN3 (R577X), ACE (I/D), BDKRB2 (-9/+9) and AGT (M268T) with Brazilian elite and sub-elite swimmers.

Conclusion

The findings of the present study provide relevant considerations regarding the identification of strength/power and endurance talents in swimming. Elite and sub-elite athletes showed similar genotype frequencies to non-athletes. Our results indicate that the allele and genotype frequency of ACE and ACTN3 should be taken into account as possible candidates for sports performance in swimming athletes. On the other hand, we could not observe the same interaction regarding the polymorphisms of the AGT and BDKRB2 genes for the same sample group.

Data availability

The datasets generated and/or analyzed during the current study are available in the Figshare repository and can be found at https://doi.org/10.6084/m9.figshare.24913146.

Abbreviations

ACE:

Angiotensin-converting enzyme

ACTN3:

Alpha-actinin-3

AGT:

Angiotensinogen

BDKRB2:

Bradykinin B2 receptor

DNA:

Deoxyribonucleic acid

IGF:

Insulin-like growth factor

IL6:

Interleukin-6

MSTN:

Myostatin

OR:

Odds ratio

PPARA:

Peroxisome proliferator-activated receptor alpha

PPARGC1A:

PPARG coactivator 1 alpha

VEGFR2:

Vascular endothelial growth factor receptor 2

χ2:

Chi-square

References

  1. Ahmetov II, Hall ECR, Semenova EA, et al. Advances in sports genomics. Adv Clin Chem. 2022;107:215–63.

    Article  CAS  PubMed  Google Scholar 

  2. Jacques M, Eynon N, Hanson ED. Genetics and Sprint, Strength, and Power Performance: Candidate Gene Versus Genome-Wide Association Study approaches. In: Bagchi D, Nair S, Sen C, editors Nutrition and enhanced sports performance. London: Elsevier, pp. 371–83.

  3. de Albuquerque-Neto SL, Herrera JJB, Rosa TS, et al. Interaction between ACTN3 (R577X), ACE (I/D), and BDKRB2 (-9/+9) polymorphisms and endurance phenotypes in Brazilian long-distance swimmers. J Strength Cond Res. 2020;1:1–5.

    Google Scholar 

  4. Guilherme JPLF, Bertuzzi R, Lima-Silva AE, et al. Analysis of sports-relevant polymorphisms in a large Brazilian cohort of top-level athletes. Ann Hum Genet. 2018;82:254–64.

    Article  CAS  PubMed  Google Scholar 

  5. de Albuquerque-Neto SL, De Melo GF, Silva GCB, et al. Association of ACTN 3 genotypes to performance indicators in Brazilian swimming junior athletes specialists in short distances. Motricidade. 2018;14:66–71.

    Google Scholar 

  6. Zmijewski P, Grenda A, Leońska-Duniec A, et al. Effect of BDKRB2 gene– 9/+9 polymorphism on training improvements in competitive swimmers. J Strength Cond Res. 2016;30:665–71.

    Article  PubMed  Google Scholar 

  7. Sawczuk M, Timshina YI, Astratenkova IV, et al. The– 9/+9 polymorphism of the bradykinin receptor beta 2 Gene and athlete status: a study involving two European cohorts. Hum Biol. 2013;85:741–55.

    PubMed  Google Scholar 

  8. Almeida SS, Naffah-Mazzacoratti MG, Guimarães PB, et al. Carbamazepine inhibits angiotensin I-converting enzyme, linking it to the pathogenesis of temporal lobe epilepsy. Transl Psychiatry. 2012;2:e93–3.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  9. Rodriguez S, Gaunt TR, Day INMM. Hardy-Weinberg equilibrium testing of biological ascertainment for mendelian randomization studies. Am J Epidemiol. 2009;169:505–14.

    Article  PubMed  PubMed Central  Google Scholar 

  10. Cohen J. Statistical power analysis for the behavioral sciences. 2nd ed. Hillsdale, NJ: Lawrence Erlbaum; 1988.

    Google Scholar 

  11. Zmijewski P, Leońska-Duniec A, Stuła A, et al. Evaluation of the association of comt rs4680 polymorphism with swimmers’ competitive performance. Genes (Basel). 2021;12. https://doi.org/10.3390/genes12101641. Epub ahead of print.

  12. Ben-Zaken S, Eliakim A, Nemet D, et al. Genetic characteristics of competitive swimmers: a review. Biol Sport. 2022;39:157–70.

    Article  PubMed  Google Scholar 

  13. Boulygina EA, Borisov OV, Valeeva EV, et al. Whole genome sequencing of elite athletes. Biol Sport. 2020;37:295–304.

    Article  PubMed  PubMed Central  Google Scholar 

  14. Li Y, Wang LQ, Yi L, et al. ACTN3 R577X genotype and performance of elite middle-long distance swimmers in China. Biol Sport. 2017;34:39–43.

    Article  CAS  PubMed  Google Scholar 

  15. Eynon N, Ruiz JR, Bishop DJ, et al. The rs12594956 polymorphism in the NRF-2 gene is associated with top-level Spanish athlete’s performance status. J Sci Med Sport. 2013;16:135–9.

    Article  PubMed  Google Scholar 

  16. Grenda A, Leońska-Duniec A, Kaczmarczyk M, et al. Interaction between ACE I/D and ACTN3 R557X polymorphisms in Polish competitive swimmers. J Hum Kinet. 2014;42:127–36.

    Article  PubMed  PubMed Central  Google Scholar 

  17. Orysiak J, Busko K, Michalski R, et al. Relationship between ACTN3 R577x polymorphism and maximal power output in elite Polish athletes. Med (B Aires). 2014;50:303–8.

    Google Scholar 

  18. Ben-Zaken S, Eliakim A, Nemet D, et al. ACTN3 polymorphism: comparison between Elite swimmers and runners. Sport Med - Open. 2015;1. https://doi.org/10.1186/s40798-015-0023-y. Epub ahead of print.

  19. Wang G, Mikami ERI, Chiu L-L, et al. Association Analysis of ACE and ACTN3 in Elite caucasian and east Asian swimmers. Med Sci Sport Exerc. 2013;45:892–900.

    Article  CAS  Google Scholar 

  20. Zmijewski P, Cieszczyk P, Ahmetov II, et al. The NOS3 G894T (rs1799983) and– 786T/C (rs2070744) polymorphisms are associated with elite swimmer status. Biol Sport. 2018;35:313–9.

    Article  PubMed  PubMed Central  Google Scholar 

  21. Ben-Zaken S, Meckel Y, Nemet D, et al. Increased prevalence of the IL-6-174 C genetic polymorphism in Long Distance swimmers. J Hum Kinet. 2017;58:121–30.

    Article  PubMed  PubMed Central  Google Scholar 

  22. Ben-Zaken S, Meckel Y, Nemet D, et al. Frequency of the MSTN Lys(K)-153Arg(R) polymorphism among track & field athletes and swimmers. Growth Horm IGF Res. 2015;25:196–200.

    Article  CAS  PubMed  Google Scholar 

  23. Ahmetov II, Popov DV, Lyubaeva EV, et al. Association of the VEGFR2 gene His472Gln polymorphism with endurance-related phenotypes. Eur J Appl Physiol. 2009;107:95–103.

    Article  CAS  PubMed  Google Scholar 

  24. Ahmetov II, Egorova ES, Gabdrakhmanova LJ, et al. Genes and athletic performance: an update. Genet Sport. 2016;61:41–54.

    Article  Google Scholar 

  25. Petr M, Thiel D, Kateřina K, et al. Speed and power-related gene polymorphisms associated with playing position in elite soccer players. Biol Sport. 2022;39:355–66.

    Article  PubMed  Google Scholar 

  26. Costa AM, Silva AJ, Garrido ND, et al. Association between ACE D allele and elite short distance swimming. Eur J Appl Physiol. 2009;106:785–90.

    Article  CAS  PubMed  Google Scholar 

  27. Sgourou A, Fotopoulos V, Kontos V, et al. Association of genome variations in the renin-angiotensin system with physical performance. Hum Genomics. 2012;6:1.

    Article  Google Scholar 

  28. Cam S, Colakoglu M, Colakoglu S, et al. ACE I/D gene polymorphism and aerobic endurance development in response to training in a non-elite female cohort. J Sports Med Phys Fitness. 2007;47:234–8.

    CAS  PubMed  Google Scholar 

  29. da Rosa PC, Oneda G, Daros LB, et al. Can a genetic profile be related to performance in young talent track and field athletes? A pilot study. Motriz Rev Educ Fis. 2022;28:28–35.

    Article  Google Scholar 

  30. Sjúrðarson T, Bejder J, Breenfeldt Andersen A, et al. Effect of angiotensin-converting enzyme inhibition on cardiovascular adaptation to exercise training. Physiol Rep. 2022;10:1–13.

    Article  Google Scholar 

  31. Ortiz AM, Laguarta-Val S, Varillas-Delgado D. Muscle Work and Its Relationship with ACE and ACTN3 Polymorphisms Are Associated with the Improvement of Explosive Strength. Genes (Basel); 12. Epub ahead of print 2021. https://doi.org/10.3390/genes12081177.

  32. Kang HJ, Kim CH, Park DS, et al. The impacts of ACE activity according to ACE I/D polymorphisms on muscular functions of people aged 65. Ann Rehabil Med. 2012;36:433–46.

    Article  PubMed  PubMed Central  Google Scholar 

  33. Ipekoglu G, Bulbul A, Cakir HI. A meta-analysis on the association of ACE and PPARA gene variants and endurance athletic status. J Sport Med Phys Fit. 2022;62:795–802.

    Google Scholar 

  34. Labudová J, Rýzková E, Raichwalderová K, et al. The response to the training load in the aquatic environment in terms of the stimulation of the reflective capabilities of Elite Synchronized swimmers. Acta Fac Educ Phys Univ Comenianae. 2020;60:170–81.

    Google Scholar 

  35. McAuley ABT, Hughes DC, Tsaprouni LG, et al. The association of the ACTN3 R577X and ACE I/D polymorphisms with athlete status in football: a systematic review and meta-analysis. J Sports Sci. 2021;39:200–11.

    Article  PubMed  Google Scholar 

  36. Kim DS, Wheeler MT, Ashley EA. The genetics of human performance. Nat Rev Genet. 2022;23:40–54.

    Article  CAS  PubMed  Google Scholar 

  37. Grenda A, Leońska-Duniec A, Cieszczyk P, et al. BDKRB2 gene– 9/+9 polymorphism and swimming performance. Biol Sport. 2014;31:109–13.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  38. Ahmetov II, Druzhevskaya AM, Astratenkova IV, et al. The ACTN3 R577X polymorphism in Russian endurance athletes. Br J Sports Med. 2010;44:649–52.

    Article  CAS  PubMed  Google Scholar 

  39. Ruiz JR, Gómez-Gallego F, Santiago C, et al. Is there an optimum endurance polygenic profile? J Physiol. 2009;587:1527–34.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  40. Monnerat G, Maior AS, Tannure M, et al. Single-nucleotide-polymorphism-panel population-genetics approach based on the 1000 genomes database and elite soccer players. Int J Sports Physiol Perform. 2019;14:711–7.

    Article  PubMed  Google Scholar 

Download references

Acknowledgements

We would like to thank all the participants who volunteered for this study, as well as Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES, Brazil), Fundação de Amparo à Pesquisa e ao Desenvolvimento Científico e Tecnológico do Maranhão (FAPEMA BD-02488/21) and Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP#2018/16565-0) for supporting this study.

Funding

This study received no external funding.

Author information

Authors and Affiliations

  1. União Educacional do Nordeste (UNINORDESTE), João Pessoa, Paraíba, Brazil

    Severino Leão de Albuquerque-Neto

  2. Department of Biophysics and Physiology, Nucleus of Study in Physiology Applied to Performance and Health (NEFADS), Federal University of Piaui, Teresina, Piauí, Brazil

    Marcos Antonio Pereira dos Santos, Valmir Oliveira Silvino & Cirley Pinheiro Ferreira

  3. Rede Nordeste de Biotecnologia (RENORBIO), Federal University of Piauí, Teresina, Piauí, Brazil

    Marcos Antonio Pereira dos Santos, Valmir Oliveira Silvino & Cirley Pinheiro Ferreira

  4. Brazilian Confederation of Aquatic Sports, Rio de Janeiro, Rio de Janeiro, Brazil

    Jose Juan Blanco Herrera

  5. Department of Physical Education, Catholic University of Brasília, Brasília, DF, Brazil

    Thiago Santos Rosa & Gislane Ferreira de Melo

  6. Department of Physical Education, State University of Piauí, Barros Araújo Campus, Picos, Piauí, Brazil

    Glauber Castelo Branco Silva

  7. School of Health and Behavioural Sciences, The University of the Sunshine Coast, Sippy Downs, QLD, Australia

    Bruno Pena Couto

  8. Associated Postgraduate Program in Physical Education of the Federal University of Pernambuco, Federal University of Paraíba, João Pessoa, Brazil

    Alexandre Sérgio Silva

  9. Hospital Israelita Albert Einstein, São Paulo, São Paulo, Brazil

    Sandro Soares de Almeida

  10. Universidade Ibirapuera, São Paulo, São Paulo, Brazil

    Sandro Soares de Almeida

  11. Universidade Anhanguera, Guarulhos, São Paulo, Brazil

    Sandro Soares de Almeida

Authors
  1. Severino Leão de Albuquerque-Neto
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Marcos Antonio Pereira dos Santos
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Valmir Oliveira Silvino
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Jose Juan Blanco Herrera
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Thiago Santos Rosa
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Glauber Castelo Branco Silva
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Bruno Pena Couto
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Cirley Pinheiro Ferreira
    View author publications

    You can also search for this author in PubMed Google Scholar

  9. Alexandre Sérgio Silva
    View author publications

    You can also search for this author in PubMed Google Scholar

  10. Sandro Soares de Almeida
    View author publications

    You can also search for this author in PubMed Google Scholar

  11. Gislane Ferreira de Melo
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

SLAN and GFM conceptualized the study. SLAN, JJBH, SSA, and GFM collected the data. VOS, ASS, and SSA analyzed the data. TSR, GCBS, BPN, CPF, and SSA performed the data interpretation. SLAN, VOS, and CPF wrote the original draft. SLAN, MAPS, and SSA wrote, reviewed and edited the final version of the manuscript. All authors read and approved the final version of the manuscript.

Corresponding author

Correspondence to Marcos Antonio Pereira dos Santos.

Ethics declarations

Ethics approval and consent to participate

This study was carried out in accordance with the principles of the Declaration of Helsink and was approved in 2015 by the Research Ethics Committee of the Brasilia Catholic University, Brazil, under protocol 1.319.640. All subjects signed the informed consent form according to resolution 466/12 of the National Health Council.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

de Albuquerque-Neto, S.L., Santos, M.P., Silvino, V.O. et al. Association between ACTN3 (R577X), ACE (I/D), BDKRB2 (-9/+9), and AGT (M268T) polymorphisms and performance phenotypes in Brazilian swimmers. BMC Sports Sci Med Rehabil 16, 50 (2024). https://doi.org/10.1186/s13102-024-00828-2

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s13102-024-00828-2

Keywords

BMC Sports Science, Medicine and Rehabilitation

ISSN: 2052-1847

Contact us